pX459-sgAAVS1
(Plasmid
#184403)
-
PurposepX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGAT
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184403 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX459
- Backbone size w/o insert (bp) 9158
- Total vector size (bp) 9178
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAVS1-specific sgRNA
-
gRNA/shRNA sequenceGGGGCCACTAGGGACAGGAT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
- Promoter U6 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGGCCTATTTCCCATGAT
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sgRNA 20 bp targeting sequence is specific for AAVS1. Express this plasmid in cultured human cells to induce Cas9-mediated cutting of AAVS1; include donor plasmid with AAVS1-specific homology arms to stably integrate DNA at AAVS1 locus.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459-sgAAVS1 was a gift from Robert Bradley (Addgene plasmid # 184403 ; http://n2t.net/addgene:184403 ; RRID:Addgene_184403) -
For your References section:
Nonsense-mediated mRNA decay uses complementary mechanisms to suppress mRNA and protein accumulation. Udy DB, Bradley RK. Life Sci Alliance. 2021 Dec 8;5(3). pii: 5/3/e202101217. doi: 10.26508/lsa.202101217. Print 2022 Mar. 10.26508/lsa.202101217 PubMed 34880103