gRNA-MS2x2-TagRFP657
(Plasmid
#184441)
-
PurposesgRNA with MS2 aptamer, TagRFP657 as selection marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184441 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA-MS2x2, TagRFP657
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gaatagagttaggcagggatattc
- 3′ sequencing primer CCTATAGTGAGTCGTATTA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Read the preprint at bioRxiv: https://www.biorxiv.org/content/10.1101/2021.09.11.459888v1.full
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gRNA-MS2x2-TagRFP657 was a gift from Rhys Allan (Addgene plasmid # 184441 ; http://n2t.net/addgene:184441 ; RRID:Addgene_184441) -
For your References section:
Activation of stably silenced genes by recruitment of a synthetic de-methylating module. Chan WF, Coughlan HD, Chen Y, Keenan CR, Smyth GK, Perkins AC, Johanson TM, Allan RS. Nat Commun. 2022 Sep 23;13(1):5582. doi: 10.1038/s41467-022-33181-4. 10.1038/s41467-022-33181-4 PubMed 36151095