Skip to main content
Addgene

pLenti_Ef1a:PE2-P2A-hMLH1dn
(Plasmid #184444)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184444 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV
  • Backbone manufacturer
    SignaGen Inc
  • Backbone size (bp) 16482
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Promoter U6 and Ef1A

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GTGCAGGGGAAAGAATAGTAGACA
  • 3′ sequencing primer CGTAGAACCCAGAGATCGCT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    SignaGen Laboratories

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

From the 184445 backbone which was partly generated by SignaGen Inc. we extracted the PE2-P2A-GFP insert and replaced this with the PEmax editor. For details on the cloning see 184445

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti_Ef1a:PE2-P2A-hMLH1dn was a gift from Bobby Koeleman (Addgene plasmid # 184444 ; http://n2t.net/addgene:184444 ; RRID:Addgene_184444)
  • For your References section:

    Increased prime edit rates in KCNQ2 and SCN1A via single nicking all-in-one plasmids. Dirkx N, Weuring WJ, De Vriendt E, Smal N, van de Vondervoort J, van 't Slot R, Koetsier M, Zonnekein N, De Pooter T, Weckhuysen S, Koeleman BPC. BMC Biol. 2023 Jul 13;21(1):156. doi: 10.1186/s12915-023-01646-7. 10.1186/s12915-023-01646-7 PubMed 37443005