Skip to main content

pX458-GFP-TRIM28
(Plasmid #185010)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185010 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    px458
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TRIM28 sgRNA
  • gRNA/shRNA sequence
    CGTGTGAATGGCGGCCTCGG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Trim28 (a.k.a. KAP-1, KRIP-1, MommeD9, Tif1b, Tif1beta)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX458-GFP-TRIM28 was a gift from Denes Hnisz (Addgene plasmid # 185010 ; http://n2t.net/addgene:185010 ; RRID:Addgene_185010)
  • For your References section:

    Hijacking of transcriptional condensates by endogenous retroviruses. Asimi V, Sampath Kumar A, Niskanen H, Riemenschneider C, Hetzel S, Naderi J, Fasching N, Popitsch N, Du M, Kretzmer H, Smith ZD, Weigert R, Walther M, Mamde S, Meierhofer D, Wittler L, Buschow R, Timmermann B, Cisse II, Ameres SL, Meissner A, Hnisz D. Nat Genet. 2022 Aug;54(8):1238-1247. doi: 10.1038/s41588-022-01132-w. Epub 2022 Jul 21. 10.1038/s41588-022-01132-w PubMed 35864192