Skip to main content

CMV-IgK-pHluorin-TM-mRuby
(Plasmid #185546)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185546 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    CMV
  • Total vector size (bp) 6726
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IgK-pHluorin-TM-mRuby
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1680
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BlpI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-IgK-pHluorin-TM-mRuby was a gift from Jaime de Juan-Sanz (Addgene plasmid # 185546 ; http://n2t.net/addgene:185546 ; RRID:Addgene_185546)
  • For your References section:

    Activity-driven synaptic translocation of LGI1 controls excitatory neurotransmission. Cuhadar U, Calzado-Reyes L, Pascual-Caro C, Aberra AS, Ritzau-Jost A, Aggarwal A, Ibata K, Podgorski K, Yuzaki M, Geis C, Hallerman S, Hoppa MB, de Juan-Sanz J. Cell Rep. 2024 May 28;43(5):114186. doi: 10.1016/j.celrep.2024.114186. Epub 2024 May 2. 10.1016/j.celrep.2024.114186 PubMed 38700985