Skip to main content

pCAGGS SARS-CoV-2 BA.4/5 Spike
(Plasmid #186031)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 186031 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *
DNA 186031-D50 50 μg of DNA in Tris buffer $495 *
DNA 186031-D100 100 μg of DNA in Tris buffer $585 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pCAGGS
  • Backbone size w/o insert (bp) 4716
  • Total vector size (bp) 8523
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 BA.4/5 Spike
  • Alt name
    SARS-CoV-2 Omicron Spike
  • Insert Size (bp)
    3806
  • Mutation
    BA.2 mutations (T19I, LPPA24S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) with a Q493 reversion and Δ69-70, L452R and F486V
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter chicken β-actin promoter, CMV enhancer

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CTCTAGAGCCTCTGCTAACCATGTTC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.08.03.22278386 for medRxiv preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS SARS-CoV-2 BA.4/5 Spike was a gift from Marceline Côté (Addgene plasmid # 186031 ; http://n2t.net/addgene:186031 ; RRID:Addgene_186031)
  • For your References section:

    Spike recognition and neutralization of SARS-CoV-2 Omicron subvariants elicited after the third dose of mRNA vaccine. Tauzin A, Nicolas A, Ding S, Benlarbi M, Medjahed H, Chatterjee D, Dionne K, Gong SY, Gendron-Lepage G, Bo Y, Perreault J, Goyette G, Gokool L, Arlotto P, Morrisseau C, Tremblay C, Martel-Laferriere V, De Serres G, Levade I, Kaufmann DE, Cote M, Bazin R, Finzi A. Cell Rep. 2023 Jan 31;42(1):111998. doi: 10.1016/j.celrep.2023.111998. Epub 2023 Jan 9. 10.1016/j.celrep.2023.111998 PubMed 36656710