Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

mNeon-Vamp2
(Plasmid #186619)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 186619 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Vesicle Associated Membrane Protein 2
  • Alt name
    Vamp2
  • Alt name
    SYB2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    354
  • GenBank ID
    NM_001330125.1
  • Entrez Gene
    VAMP2 (a.k.a. NEDHAHM, SYB2, VAMP-2)
  • Promoter CMV
  • Tag / Fusion Protein
    • mNeonGreen (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ggggaggtgtgggaggt
  • 3′ sequencing primer accgagctcaacttcaaggag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mNeon-Vamp2 was a gift from Gia Voeltz (Addgene plasmid # 186619 ; http://n2t.net/addgene:186619 ; RRID:Addgene_186619)
  • For your References section:

    The ER ladder is a unique morphological feature of developing mammalian axons. Zamponi E, Meehl JB, Voeltz GK. Dev Cell. 2022 Jun 6;57(11):1369-1382.e6. doi: 10.1016/j.devcel.2022.05.002. Epub 2022 May 23. 10.1016/j.devcel.2022.05.002 PubMed 35609616