Skip to main content
Addgene

pMCSGC-GB1
(Plasmid #186786)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186786 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMCSG53
  • Backbone manufacturer
    Eschenfeldt, W. H., Makowska-Grzyska, M., Stols, L., Donnelly, M. I., Jedrzejczak, R., & Joachimiak, A.
  • Backbone size (bp) 5834
  • Modifications to backbone
    The B1 domain of the Streptococcal protein G (GB1) has been added in-frame downstream of the 6His tag. Removal of ccdB is via SspI digestion
  • Vector type
    Bacterial Expression
  • Promoter T7

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMCSGC-GB1 was a gift from Alexei Savchenko (Addgene plasmid # 186786 ; http://n2t.net/addgene:186786 ; RRID:Addgene_186786)
  • For your References section:

    Recombinant production of growth factors for application in cell culture. Venkatesan M, Semper C, Skrivergaard S, Di Leo R, Mesa N, Rasmussen MK, Young JF, Therkildsen M, Stogios PJ, Savchenko A. iScience. 2022 Sep 3;25(10):105054. doi: 10.1016/j.isci.2022.105054. eCollection 2022 Oct 21. 10.1016/j.isci.2022.105054 PubMed 36157583