pMCSGC-GB1
(Plasmid
#186786)
-
Purpose(Empty Backbone) E. coli expression vector containing N-terminal 6His-GB1-TEV fusion.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186786 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMCSG53
-
Backbone manufacturerEschenfeldt, W. H., Makowska-Grzyska, M., Stols, L., Donnelly, M. I., Jedrzejczak, R., & Joachimiak, A.
- Backbone size (bp) 5834
-
Modifications to backboneThe B1 domain of the Streptococcal protein G (GB1) has been added in-frame downstream of the 6His tag. Removal of ccdB is via SspI digestion
-
Vector typeBacterial Expression
- Promoter T7
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Read the preprint on bioRxiv: https://www.biorxiv.org/content/10.1101/2022.02.15.480596v1.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMCSGC-GB1 was a gift from Alexei Savchenko (Addgene plasmid # 186786 ; http://n2t.net/addgene:186786 ; RRID:Addgene_186786) -
For your References section:
Recombinant production of growth factors for application in cell culture. Venkatesan M, Semper C, Skrivergaard S, Di Leo R, Mesa N, Rasmussen MK, Young JF, Therkildsen M, Stogios PJ, Savchenko A. iScience. 2022 Sep 3;25(10):105054. doi: 10.1016/j.isci.2022.105054. eCollection 2022 Oct 21. 10.1016/j.isci.2022.105054 PubMed 36157583