Skip to main content

mEmerald(luminal)-canxTM
(Plasmid #186961)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186961 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5345
  • Total vector size (bp) 6458
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CANX
  • Alt name
    calnexin
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    333
  • Mutation
    Only express calnexin (482-end) with ER signal peptide from calnexin at N terminus
  • Entrez Gene
    CANX (a.k.a. CNX, IP90, P90)
  • Promoter CMV Promoter
  • Tag / Fusion Protein
    • mEmerald (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer tagaaggcacagtcgagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mEmerald(luminal)-canxTM was a gift from Ke Xu (Addgene plasmid # 186961 ; http://n2t.net/addgene:186961 ; RRID:Addgene_186961)
  • For your References section:

    The endoplasmic reticulum adopts two distinct tubule forms. Wang B, Zhao Z, Xiong M, Yan R, Xu K. Proc Natl Acad Sci U S A. 2022 May 3;119(18):e2117559119. doi: 10.1073/pnas.2117559119. Epub 2022 Apr 26. 10.1073/pnas.2117559119 PubMed 35471903