pnxABE-flgn
(Plasmid
#187932)
-
PurposeA-to-G base editor
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187932 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonecolE1
- Total vector size (bp) 10279
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameecTadA(8e)-nxCas9 (D10A)
-
gRNA/shRNA sequenceflgn
-
SpeciesP. chengduensis DY56–96
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tctcgtttggattgcaactggtc
- 3′ sequencing primer ttggccagggtcagggc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pnxABE-flgn was a gift from Yi Xiao (Addgene plasmid # 187932 ; http://n2t.net/addgene:187932 ; RRID:Addgene_187932) -
For your References section:
Adenine Base Editing System for Pseudomonas and Prediction Workflow for Protein Dysfunction via ABE. Abdullah, Wang P, Han T, Liu W, Ren W, Wu Y, Xiao Y. ACS Synth Biol. 2022 Apr 15;11(4):1650-1657. doi: 10.1021/acssynbio.2c00066. Epub 2022 Apr 7. 10.1021/acssynbio.2c00066 PubMed 35389616