pBM4607
(Plasmid
#18795)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 18795 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepOBD2
- Backbone size w/o insert (bp) 7167
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSir4
-
Alt nameSTE9
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)891
-
Mutationaa 951-1200
-
GenBank IDM37249
-
Entrez GeneSIR4 (a.k.a. YDR227W, ASD1, STE9, UTH2)
-
Tag
/ Fusion Protein
- myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CACAATATTTCAAGCTATACC
- 3′ sequencing primer CTCATCAACCAACGAAACGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBM4607 was a gift from Mark Johnston (Addgene plasmid # 18795 ; http://n2t.net/addgene:18795 ; RRID:Addgene_18795) -
For your References section:
'Calling Cards' method for high-throughput identification of targets of yeast DNA-binding proteins. Wang H, Heinz ME, Crosby SD, Johnston M, Mitra RD. Nat Protoc. 2008;3(10):1569-77. doi: 10.1038/nprot.2008.148. 10.1038/nprot.2008.148 PubMed 18802438