-
PurposeCloning vector for generating part plasmids, with mNeonGreen dropout following BsmBI digestion
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 189966 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRC
- Backbone size w/o insert (bp) 1874
- Total vector size (bp) 2806
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemNeonGreen
-
SpeciesSynthetic
-
Insert Size (bp)932
- Promoter BBa-J23100
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCCTGATTCTGTGGATAACCGT
- 3′ sequencing primer gattaagcattggtaactgtcagaccaa
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRC0569 (parts entry vector) was a gift from Howard Chang (Addgene plasmid # 189966 ; http://n2t.net/addgene:189966 ; RRID:Addgene_189966) -
For your References section:
Engineering circular RNA for enhanced protein production. Chen R, Wang SK, Belk JA, Amaya L, Li Z, Cardenas A, Abe BT, Chen CK, Wender PA, Chang HY. Nat Biotechnol. 2022 Jul 18. pii: 10.1038/s41587-022-01393-0. doi: 10.1038/s41587-022-01393-0. 10.1038/s41587-022-01393-0 PubMed 35851375