CMV-mCherry-3’UTR of β-actin-(F30-2xdBroccoli)6
(Plasmid
#190162)
-
PurposeExpresses 24 Broccoli-tagged beta-actin mRNA in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190162 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA 3
- Backbone size w/o insert (bp) 3872
- Total vector size (bp) 7872
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemcherry_(3'UTR, No Actin)_24Broccoli
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3982
- Promoter CMV
-
Tag
/ Fusion Protein
- 24×Broccoli (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer AAATGGGCGGTAGGCGTG
- 3′ sequencing primer ccagtttggaacaagagtccac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-mCherry-3’UTR of β-actin-(F30-2xdBroccoli)6 was a gift from Samie Jaffrey (Addgene plasmid # 190162 ; http://n2t.net/addgene:190162 ; RRID:Addgene_190162) -
For your References section:
Fluorophore-Promoted RNA Folding and Photostability Enables Imaging of Single Broccoli-Tagged mRNAs in Live Mammalian Cells. Li X, Kim H, Litke JL, Wu J, Jaffrey SR. Angew Chem Int Ed Engl. 2020 Mar 9;59(11):4511-4518. doi: 10.1002/anie.201914576. Epub 2020 Jan 28. 10.1002/anie.201914576 PubMed 31850609