pSelect-6
(Plasmid
#190243)
-
PurposeEncodes lacI- and GFP-targeting gRNAs for positive and negative selections of dCas9 activity.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190243 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSKunk-BLA
- Total vector size (bp) 5783
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLacI
-
gRNA/shRNA sequencegctggcctggttcaccacgc
-
SpeciesE. coli
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bygRNA obtained from pgRNA (Addgene #44251), LacI from pMJ842 (Addgene #39318), and backbone derived from pSKunk-BLA (Addgene #61531).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSelect-6 was a gift from Marc Ostermeier (Addgene plasmid # 190243 ; http://n2t.net/addgene:190243 ; RRID:Addgene_190243) -
For your References section:
A bacterial dual positive and negative selection system for dCas9 activity. Spisak S, O'Brien B, Ostermeier M. PLoS One. 2022 Jun 3;17(6):e0269270. doi: 10.1371/journal.pone.0269270. eCollection 2022. 10.1371/journal.pone.0269270 PubMed 35657952