pJB06
(Plasmid
#190480)
-
PurposeBase Cas9 expression plasmid for 2-plasmid C. difficile mutagenesis system
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190480 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHN149
- Backbone size w/o insert (bp) 7084
- Total vector size (bp) 12489
-
Vector typeE. coli / B. subtilis - C. difficile shuttle vector
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCas9
-
SpeciesS. pyogenes
-
Insert Size (bp)4107
- Promoter xylR-driven promoter
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGGAGGGTAAAGAGGAGAGttaattaa
- 3′ sequencing primer tgccaagcttgcatgtctgcaggcctcgag (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameXylR
-
Insert Size (bp)1227
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer caatttttttatcaggaaacagctatgacc
- 3′ sequencing primer TAATAATAAAATATTTAATTATCTTTGTCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJB06 was a gift from Joseph Sorg (Addgene plasmid # 190480 ; http://n2t.net/addgene:190480 ; RRID:Addgene_190480) -
For your References section:
Plasmid Sequence and Availability for an Improved Clostridioides difficile CRISPR-Cas9 Mutagenesis System. Brehm JN, Sorg JA. Microbiol Resour Announc. 2022 Dec 15;11(12):e0083322. doi: 10.1128/mra.00833-22. Epub 2022 Nov 7. 10.1128/mra.00833-22 PubMed 36342279