pJB07
(Plasmid
#190481)
-
PurposeTargeting plasmid for 2-plasmid C. difficile mutagenesis system
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190481 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJB11
- Total vector size (bp) 8357
-
Modifications to backboneAddition of region of homology for pyrE deletion, gRNA, xylR-driven promotion region
-
Vector typeE. coli / B. subtilis - C. difficile shuttle vector
Growth in Bacteria
-
Bacterial Resistance(s)Erythromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameUpstream & Downstream pyrE deletion region
-
SpeciesC. difficile
-
Insert Size (bp)2000
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ttatcaggaaacagctatgaccgcggccgc
- 3′ sequencing primer agugccaaguugcaugucugcaggcucgag
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namegRNA
-
Insert Size (bp)140
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer TTATGAAGTGGCATTCAAGGAGGGggtacc
- 3′ sequencing primer caggcuucuuauuuuuaugcuagcACGCGU
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJB07 was a gift from Joseph Sorg (Addgene plasmid # 190481 ; http://n2t.net/addgene:190481 ; RRID:Addgene_190481) -
For your References section:
Plasmid Sequence and Availability for an Improved Clostridioides difficile CRISPR-Cas9 Mutagenesis System. Brehm JN, Sorg JA. Microbiol Resour Announc. 2022 Dec 15;11(12):e0083322. doi: 10.1128/mra.00833-22. Epub 2022 Nov 7. 10.1128/mra.00833-22 PubMed 36342279