pWPT-mCherry
(Plasmid
#190605)
-
PurposeObtained by cloning 5 stop codons in place of the EGFP Kozak sequence in pWPT-/mEGFP-1T-IRES-mCherry
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190605 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePlasmid 49235: pWPT-/GCCACC-mEGFP-IRES-mCherry
- Backbone size w/o insert (bp) 10727
- Total vector size (bp) 10721
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemEGFP
-
SpeciesSynthetic
-
Insert Size (bp)738
-
MutationEGFP Kozak sequence has been replaced with a stretch of stop codons, impeding EGFP expression.
- Promoter EIF1-short
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ATAAGTGCAGTAGTCGCCGT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)711
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWPT-mCherry was a gift from Alessandro Quattrone (Addgene plasmid # 190605 ; http://n2t.net/addgene:190605 ; RRID:Addgene_190605) -
For your References section:
Translational enhancement by base editing of the Kozak sequence rescues haploinsufficiency. Ambrosini C, Destefanis E, Kheir E, Broso F, Alessandrini F, Longhi S, Battisti N, Pesce I, Dassi E, Petris G, Cereseto A, Quattrone A. Nucleic Acids Res. 2022 Oct 14;50(18):10756-10771. doi: 10.1093/nar/gkac799. 10.1093/nar/gkac799 PubMed 36165847