pMD19-PBBa_J23117-sgRNA-Spr
(Plasmid
#190793)
-
PurposeTemplate vector to amplify single sgRNAs or pieces for multiplexing arrays. Has flanking BsaI-sites.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190793 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMD19
-
Backbone manufacturerTakara
- Backbone size w/o insert (bp) 2125
- Total vector size (bp) 3987
-
Modifications to backboneA silent mutation of a BsaI-site found in the AmpR gene. A B0015 terminator and SpR cassette has been added to the backbone.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Spectinomycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA (dummy)
-
gRNA/shRNA sequenceACTATATTTTTCAAAGATGA
-
SpeciesSynthetic
- Promoter BBa_J23117
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI, SpeI (destroyed during cloning)
- 5′ sequencing primer -
- 3′ sequencing primer - (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMD19-PBBa_J23117-sgRNA-Spr was a gift from Paul Hudson (Addgene plasmid # 190793 ; http://n2t.net/addgene:190793 ; RRID:Addgene_190793) -
For your References section:
Inducible CRISPR/Cas9 Allows for Multiplexed and Rapidly Segregated Single-Target Genome Editing in Synechocystis Sp. PCC 6803. Cengic I, Canadas IC, Minton NP, Hudson EP. ACS Synth Biol. 2022 Aug 15. doi: 10.1021/acssynbio.2c00375. 10.1021/acssynbio.2c00375 PubMed 35969224