Skip to main content

pMD19-PBBa_J23117-sgRNA-Spr
(Plasmid #190793)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190793 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMD19
  • Backbone manufacturer
    Takara
  • Backbone size w/o insert (bp) 2125
  • Total vector size (bp) 3987
  • Modifications to backbone
    A silent mutation of a BsaI-site found in the AmpR gene. A B0015 terminator and SpR cassette has been added to the backbone.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Spectinomycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA (dummy)
  • gRNA/shRNA sequence
    ACTATATTTTTCAAAGATGA
  • Species
    Synthetic
  • Promoter BBa_J23117

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI, SpeI (destroyed during cloning)
  • 5′ sequencing primer -
  • 3′ sequencing primer -
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMD19-PBBa_J23117-sgRNA-Spr was a gift from Paul Hudson (Addgene plasmid # 190793 ; http://n2t.net/addgene:190793 ; RRID:Addgene_190793)
  • For your References section:

    Inducible CRISPR/Cas9 Allows for Multiplexed and Rapidly Segregated Single-Target Genome Editing in Synechocystis Sp. PCC 6803. Cengic I, Canadas IC, Minton NP, Hudson EP. ACS Synth Biol. 2022 Aug 15. doi: 10.1021/acssynbio.2c00375. 10.1021/acssynbio.2c00375 PubMed 35969224