pcDNA3.1-SARS2-Spike-HiBiT
(Plasmid
#191212)
-
PurposeTransient expression in mammalian cells of SARS-CoV-2 (A1) spike protein tagged on the C-terminus with HiBiT, the high affinity small fragment of split nanoluciferase assay
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191212 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerThermo Fisher
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 spike_WT
-
Alt nameS
-
SpeciesSARS CoV-2
-
Insert Size (bp)477
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter CMV
-
Tag
/ Fusion Protein
- HiBiT (high affinity small nanoluciferase fragment) (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcaggatgtggtgaatcaga
- 3′ sequencing primer BGH Reverse
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-SARS2-Spike-HiBiT was a gift from Mohan Babu (Addgene plasmid # 191212 ; http://n2t.net/addgene:191212 ; RRID:Addgene_191212) -
For your References section:
Human protein interaction networks of ancestral and variant SARS-CoV-2 in organ-specific cells and bodily fluids. Broderick K, Moutaoufik MT, Saccon T, Malty R, Amin S, Phanse S, Joseph TP, Zilocchi M, Hosseinnia A, Istace Z, Hajikarimlou M, Abrar S, Fisher J, Brassard R, Perera R, Kumar A, Aoki H, Rahmatbakhsh M, Jessulat M, Kobasa D, Dehne F, Prasad B, Gagarinova A, Joanne Lemieux M, Cochrane A, Houry WA, Aly KA, Golshani A, Babu M. Nat Commun. 2025 Jul 1;16(1):5784. doi: 10.1038/s41467-025-60949-1. 10.1038/s41467-025-60949-1 PubMed 40593736