Skip to main content

pcDNA3.1-SARS2-Spike-HiBiT
(Plasmid #191212)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191212 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Thermo Fisher
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 spike_WT
  • Alt name
    S
  • Species
    SARS CoV-2
  • Insert Size (bp)
    477
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter CMV
  • Tag / Fusion Protein
    • HiBiT (high affinity small nanoluciferase fragment) (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcaggatgtggtgaatcaga
  • 3′ sequencing primer BGH Reverse
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-SARS2-Spike-HiBiT was a gift from Mohan Babu (Addgene plasmid # 191212 ; http://n2t.net/addgene:191212 ; RRID:Addgene_191212)
  • For your References section:

    Human protein interaction networks of ancestral and variant SARS-CoV-2 in organ-specific cells and bodily fluids. Broderick K, Moutaoufik MT, Saccon T, Malty R, Amin S, Phanse S, Joseph TP, Zilocchi M, Hosseinnia A, Istace Z, Hajikarimlou M, Abrar S, Fisher J, Brassard R, Perera R, Kumar A, Aoki H, Rahmatbakhsh M, Jessulat M, Kobasa D, Dehne F, Prasad B, Gagarinova A, Joanne Lemieux M, Cochrane A, Houry WA, Aly KA, Golshani A, Babu M. Nat Commun. 2025 Jul 1;16(1):5784. doi: 10.1038/s41467-025-60949-1. 10.1038/s41467-025-60949-1 PubMed 40593736