Skip to main content

pMOD4 galK-GT
(Plasmid #19183)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 19183 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pMOD4
  • Backbone manufacturer
    Epicentre
  • Backbone size w/o insert (bp) 2100
  • Vector type
    Recombineering

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    EC100pir116
  • Growth instructions
    EC100pir116 or other pir containing bacteria
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    galK
  • Species
    E.coli
  • Insert Size (bp)
    1612
  • Entrez Gene
    galK (a.k.a. b0757, ECK0746, galA)
  • Tags / Fusion Proteins
    • 50 nucleotides from N-term TAP, C-term TAP, and FLAG-GFP (N terminal on insert)
    • 50 nucleotides from N-term TAP, C-term TAP, and FLAG-GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SphI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer GTCAGTGAGCGAGGAAGCGGAAG
  • 3′ sequencing primer ATTCAGGCTGCGCAACTGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    galK sequence is from pGalK (Warming and Copeland)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMOD4 galK-GT was a gift from Al Fisher (Addgene plasmid # 19183 ; http://n2t.net/addgene:19183 ; RRID:Addgene_19183)
  • For your References section:

    A simplified, robust, and streamlined procedure for the production of C. elegans transgenes via recombineering. Zhang Y, Nash L, Fisher AL.. BMC Dev Biol. 2008 Dec 30;8(1):119. 10.1186/1471-213X-8-119 PubMed 19116030