Skip to main content

pDEST_5xUAS:EB3-mScarlet-I
(Plasmid #192358)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192358 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Gateway Tol2 destination vector with zebrafish aA-crystallin promoter driving CFP in lens
  • Total vector size (bp) 8129
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EB3
  • Alt name
    MAPRE3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    843
  • GenBank ID
    22924
  • Entrez Gene
    MAPRE3 (a.k.a. EB3, EBF3, EBF3-S, RP3)
  • Tag / Fusion Protein
    • mScarlet-I (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gtctgaaacacaggccagat
  • 3′ sequencing primer CCACATTTGTAGAGGTTTTACTTGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The EB3 cDNA was given by the Gilmour lab (Revenu et al. 2014), but was originally cloned by Stepanova et al. 2003.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEST_5xUAS:EB3-mScarlet-I was a gift from Francesca Peri (Addgene plasmid # 192358 ; http://n2t.net/addgene:192358 ; RRID:Addgene_192358)
  • For your References section:

    A role for the centrosome in regulating the rate of neuronal efferocytosis by microglia in vivo. Moller K, Brambach M, Villani A, Gallo E, Gilmour D, Peri F. Elife. 2022 Nov 18;11:e82094. doi: 10.7554/eLife.82094. 10.7554/eLife.82094 PubMed 36398880