lentiGuideFB-Puro-A
(Plasmid
#192506)
-
PurposeFor cloning of sgRNAs compatible with PspCas9. Contains a 5' direct repeat and a nd a unique sgRNA scaffold variant with a capture sequence. Cloning guide RNAs using BsmBI.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192506 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPRv2
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehU6-sgRNA-CS1-BsmBI-EFS-Puro-WPRE
-
SpeciesH. sapiens (human), Synthetic
- Promoter hU6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtacaaaatacgtgacgtag
- 3′ sequencing primer gcattaaagcagcgtatccac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit for https://www.biorxiv.org/content/10.1101/2022.02.02.478894v1 bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiGuideFB-Puro-A was a gift from Neville Sanjana (Addgene plasmid # 192506 ; http://n2t.net/addgene:192506 ; RRID:Addgene_192506) -
For your References section:
Efficient combinatorial targeting of RNA transcripts in single cells with Cas13 RNA Perturb-seq. Wessels HH, Mendez-Mancilla A, Hao Y, Papalexi E, Mauck WM 3rd, Lu L, Morris JA, Mimitou EP, Smibert P, Sanjana NE, Satija R. Nat Methods. 2023 Jan;20(1):86-94. doi: 10.1038/s41592-022-01705-x. Epub 2022 Dec 22. 10.1038/s41592-022-01705-x PubMed 36550277