Skip to main content

pCK341
(Plasmid #192640)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192640 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCD442 (Addgene #153024)
  • Backbone manufacturer
    Jesse Zalatan
  • Backbone size w/o insert (bp) 1726
  • Total vector size (bp) 7368
  • Vector type
    CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Sp.pCas9-dSpRY
  • Species
    S. pyogenes (dCas9)
  • Insert Size (bp)
    4650
  • Mutation
    dSpRY has several mutations compared to dCas9
  • Promoter Sp.pCas9

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCAACTGACTGAAATGCCTC
  • 3′ sequencing primer GCCTGGagatccttactcga
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    BBa_J23107-MCP-SoxS(R93A, S101A)
  • Species
    MS2 (MCP), E. coli (SoxS)
  • Insert Size (bp)
    802
  • Mutation
    SoxS has R93A and S101A mutations
  • Promoter BBa_J23107

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcagggtggtgaatctgcag
  • 3′ sequencing primer tcgtaagccatttccgctcg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    adapted from Benjamin Kleinstiver lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCK341 was a gift from Jesse Zalatan (Addgene plasmid # 192640 ; http://n2t.net/addgene:192640 ; RRID:Addgene_192640)
  • For your References section:

    Expanding the Scope of Bacterial CRISPR Activation with PAM-Flexible dCas9 Variants. Kiattisewee C, Karanjia AV, Legut M, Daniloski Z, Koplik SE, Nelson J, Kleinstiver BP, Sanjana NE, Carothers JM, Zalatan JG. ACS Synth Biol. 2022 Nov 15. doi: 10.1021/acssynbio.2c00405. 10.1021/acssynbio.2c00405 PubMed 36378874