pCK341
(Plasmid
#192640)
-
PurposeExpresses dSpRY and MCP-SoxS(R93A/S101A) on p15A-CmR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192640 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCD442 (Addgene #153024)
-
Backbone manufacturerJesse Zalatan
- Backbone size w/o insert (bp) 1726
- Total vector size (bp) 7368
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameSp.pCas9-dSpRY
-
SpeciesS. pyogenes (dCas9)
-
Insert Size (bp)4650
-
MutationdSpRY has several mutations compared to dCas9
- Promoter Sp.pCas9
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GCAACTGACTGAAATGCCTC
- 3′ sequencing primer GCCTGGagatccttactcga (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameBBa_J23107-MCP-SoxS(R93A, S101A)
-
SpeciesMS2 (MCP), E. coli (SoxS)
-
Insert Size (bp)802
-
MutationSoxS has R93A and S101A mutations
- Promoter BBa_J23107
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer tcagggtggtgaatctgcag
- 3′ sequencing primer tcgtaagccatttccgctcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byadapted from Benjamin Kleinstiver lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCK341 was a gift from Jesse Zalatan (Addgene plasmid # 192640 ; http://n2t.net/addgene:192640 ; RRID:Addgene_192640) -
For your References section:
Expanding the Scope of Bacterial CRISPR Activation with PAM-Flexible dCas9 Variants. Kiattisewee C, Karanjia AV, Legut M, Daniloski Z, Koplik SE, Nelson J, Kleinstiver BP, Sanjana NE, Carothers JM, Zalatan JG. ACS Synth Biol. 2022 Nov 15. doi: 10.1021/acssynbio.2c00405. 10.1021/acssynbio.2c00405 PubMed 36378874