pHR-PGK- dCas9-SunTag-P2A-HygR
              
              
                (Plasmid
                
                #193137)
              
            
            
            
          - 
            PurposeExpresses dCas9 fused to the SunTag scaffold
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193137 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepHR_PGK
 - Backbone size w/o insert (bp) 8960
 - Total vector size (bp) 15217
 - 
              Vector typeLentiviral
 - 
                Selectable markersHygromycin
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)NEB Stable
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert namedCas9-SunTag-T2A-HygR
 - 
                    SpeciesH. sapiens (human)
 - 
                  Insert Size (bp)6100
 - Promoter PGK
 
Cloning Information
- Cloning method Gibson Cloning
 - 5′ sequencing primer GCTTCAAAAGCGCACGTCTG
 - 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pHR-PGK- dCas9-SunTag-P2A-HygR was a gift from Brad Rosenberg (Addgene plasmid # 193137 ; http://n2t.net/addgene:193137 ; RRID:Addgene_193137) - 
                
For your References section:
Inducible CRISPR activation screen for interferon-stimulated genes identifies OAS1 as a SARS-CoV-2 restriction factor. Danziger O, Patel RS, DeGrace EJ, Rosen MR, Rosenberg BR. PLoS Pathog. 2022 Apr 14;18(4):e1010464. doi: 10.1371/journal.ppat.1010464. eCollection 2022 Apr. 10.1371/journal.ppat.1010464 PubMed 35421191