Skip to main content

pCXLE-SOX2-17-p2a-KLF4
(Plasmid #193290)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193290 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCXLE
  • Backbone size w/o insert (bp) 10180
  • Total vector size (bp) 12876
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SOX2-17-p2a-KLF4
  • Alt name
    superSOX
  • Alt name
    S*
  • Alt name
    KLF4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    -1
  • Mutation
    SOX2-17 is engineered highly cooperative chimeric transcription factor, where the following elements of SOX2 were swapped with SOX17: 43-47, 61, 65-86 and CTD
  • Entrez Gene
    SOX2 (a.k.a. ANOP3, MCOPS3)
  • Entrez Gene
    KLF4 (a.k.a. EZF, GKLF)
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer tctgctaaccatgttcatgccttc
  • 3′ sequencing primer AGGAAGGTCCGCTGGATTGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCXLE-SOX2-17-p2a-KLF4 was a gift from Hans Schöler (Addgene plasmid # 193290 ; http://n2t.net/addgene:193290 ; RRID:Addgene_193290)
  • For your References section:

    Highly cooperative chimeric super-SOX induces naive pluripotency across species. MacCarthy CM, Wu G, Malik V, Menuchin-Lasowski Y, Velychko T, Keshet G, Fan R, Bedzhov I, Church GM, Jauch R, Cojocaru V, Scholer HR, Velychko S. Cell Stem Cell. 2024 Jan 4;31(1):127-147.e9. doi: 10.1016/j.stem.2023.11.010. Epub 2023 Dec 22. 10.1016/j.stem.2023.11.010 PubMed 38141611