pCAGGS SARS-CoV-2 BQ.1.1 Spike
(Plasmid
#193710)
-
PurposeExpresses codon-optimized full length SARS-CoV-2 BQ.1.1 Spike
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193710 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Login to view industry pricing.
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4716
- Total vector size (bp) 8523
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 BQ.1.1 Spike
-
Alt nameSARS CoV-2 Omicron BQ.1.1 S
-
Insert Size (bp)3807
-
MutationContains the following mutations: T19I, LPPA24S, Δ69-70, G142D, V213G, G339D, R346T, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, K444T, L452R, N460K, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter chicken β-actin promoter, CMV enhancer
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CTCTAGAGCCTCTGCTAACCATGTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS SARS-CoV-2 BQ.1.1 Spike was a gift from Marceline Côté (Addgene plasmid # 193710 ; http://n2t.net/addgene:193710 ; RRID:Addgene_193710)