pMS84 (U6p::GGACAGTCCTGCCGAGGTGG)
(Plasmid
#193852)
-
PurposeEncodes the guide RNA targeting the sequence GGACAGTCCTGCCGAGGTGG
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193852 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepZCS2
- Backbone size w/o insert (bp) 2372
- Total vector size (bp) 2391
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGuide RNA
-
Alt nameGACAGTCCTGCCGAGGTGG
-
SpeciesSynthetic
-
Insert Size (bp)19
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer Tacaccttaaaggcgcacactc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byU6p and gRNA scaffold from pDD162 (acquired from Addgene)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.10.30.514301v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMS84 (U6p::GGACAGTCCTGCCGAGGTGG) was a gift from Patrick Phillips (Addgene plasmid # 193852 ; http://n2t.net/addgene:193852 ; RRID:Addgene_193852) -
For your References section:
High-throughput library transgenesis in Caenorhabditis elegans via Transgenic Arrays Resulting in Diversity of Integrated Sequences (TARDIS). Stevenson ZC, Moerdyk-Schauwecker MJ, Banse SA, Patel DS, Lu H, Phillips PC. Elife. 2023 Jul 4;12:RP84831. doi: 10.7554/eLife.84831. 10.7554/eLife.84831 PubMed 37401921