CJ8421_04975 Rptr2 and CJ8421_04975 mRNA
(Plasmid
#194210)
-
PurposeExpresses the Campylobacter mRNA CJ8421_04975 and the mRNA-targeting reprogrammed tracrRNA 2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194210 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCSM180
- Backbone size w/o insert (bp) 2116
- Total vector size (bp) 3488
-
Modifications to backboneInserts Camplybacter mRNA CJ8421_04975 and CJ8421_04975 Rptr2 via Gibson Assembly
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)One Shot™ TOP10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCJ8421_04975 mRNA and CJ8421_04975 Rptr2
-
gRNA/shRNA sequencenot applicable
-
SpeciesCampylobacter jejuni
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tcgggtttcgccacctctgact
- 3′ sequencing primer tcgctgagataggtgcctcac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CJ8421_04975 Rptr2 and CJ8421_04975 mRNA was a gift from Chase Beisel (Addgene plasmid # 194210 ; http://n2t.net/addgene:194210 ; RRID:Addgene_194210) -
For your References section:
RNA recording in single bacterial cells using reprogrammed tracrRNAs. Jiao C, Reckstadt C, Konig F, Homberger C, Yu J, Vogel J, Westermann AJ, Sharma CM, Beisel CL. Nat Biotechnol. 2023 Jan 5. doi: 10.1038/s41587-022-01604-8. 10.1038/s41587-022-01604-8 PubMed 36604543