Skip to main content

pHrD-IRES-Fluc
(Plasmid #194250)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194250 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL3
  • Total vector size (bp) 6135
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Firefly luciferase
  • Promoter human rDNA promoter and beginning of 5' ETS (-410 to +327 of pre-rRNA transcript)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
  • 3′ sequencing primer GACGATAGTCATGCCCCGCG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Samson Jacob lab (OSU); manuscript doi: 10.1074/jbc.M309393200
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid was constructed by Samson Jacob lab.

Manuscript citation:
Ghoshal K, Majumder S, Datta J, Motiwala T, Bai S, Sharma SM, Frankel W, Jacob ST. Role of human ribosomal RNA (rRNA) promoter methylation and of methyl-CpG-binding protein MBD2 in the suppression of rRNA gene expression. J Biol Chem. 2004;279(8):6783-93. doi: 10.1074/jbc.M309393200. PubMed PMID: 14610093; PMCID: 2242730.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHrD-IRES-Fluc was a gift from Samson Jacob (Addgene plasmid # 194250 ; http://n2t.net/addgene:194250 ; RRID:Addgene_194250)
  • For your References section:

    Human pre-60S assembly factors link rRNA transcription to pre-rRNA processing. McCool MA, Buhagiar AF, Bryant CJ, Ogawa LM, Abriola L, Surovtseva YV, Baserga SJ. RNA. 2022 Nov 2. pii: rna.079149.122. doi: 10.1261/rna.079149.122. 10.1261/rna.079149.122 PubMed 36323459