pAdeasy-CMV-AE-EF1α-R2
(Plasmid
#194928)
-
Purposeexpressing two fusion proteins of Ag85B-ESAT6 and Rv2031c-Rv2626c from multi-stage antigens of Mycobacterium tuberculosis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194928 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAdeasy
-
Backbone manufacturerHanBio
- Backbone size w/o insert (bp) 6500
- Total vector size (bp) 9200
-
Vector typeAdenoviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameAE
-
Alt nameAg85B-ESAT6
-
Speciesmycobacterium tuberculosis
-
Insert Size (bp)1209
-
Mutationa 48 bp linker (Gly3ser)4 was added between the two genes
-
GenBank IDene ID: 885785 Gene ID: 886209
- Promoter CMV
-
Tag
/ Fusion Protein
- Ag85B-ESAT6 (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site KpnⅠ (not destroyed)
- 3′ cloning site PvuⅠ (not destroyed)
- 5′ sequencing primer CTGGTACCGCCACCATGACCGCGGGCGCG
- 3′ sequencing primer ggcaccggagcgatcgcagatcctTCTATGCGAACATCCCAGTGA TCACTGGGATGTTCGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEEF1A1
-
Alt nameeukaryotic translation elongation factor 1 alpha 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)546
-
GenBank IDNM_001402.6
-
Entrez GeneEEF1A1 (a.k.a. CCS-3, CCS3, EE1A1, EEF-1, EEF1A, EF-Tu, EF1A, EF1A1, EF1alpha1, GRAF-1EF, LENG7, PTI1, eEF1A-1)
- Promoter EF1a
-
Tag
/ Fusion Protein
- EF1a (C terminal on backbone)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site PvuⅠ (not destroyed)
- 3′ cloning site AluⅠ (not destroyed)
- 5′ sequencing primer ACGTCACTGGGATGTTCGCATAGAaggatctgcgatcgctccg
- 3′ sequencing primer ACGGGAAGGGTGGTGGCCATGGTGGCgtaggcgccggtcacagcttg (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameR2
-
Alt nameRv2031-Rv2626
-
SpeciesMycobacterium tuberculosis
-
Insert Size (bp)918
-
Mutationa 48 bp linker (Gly3ser)4 was added between the two genes
-
GenBank IDGene ID: 887579 Gene ID: 888576
- Promoter EF1a
-
Tag
/ Fusion Protein
- Rv2031c-Rv2626c (C terminal on backbone)
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site AluⅠ (unknown if destroyed)
- 3′ cloning site XhoⅠ (not destroyed)
- 5′ sequencing primer aagctgtgaccggcgcctacGCCACCATGGCCACCACCCTTCCCGT
- 3′ sequencing primer ataaacaagttaagcttaggctcgagCTAGCTGGCGAGGGCCATGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAdeasy-CMV-AE-EF1α-R2 was a gift from Limei Wang (Addgene plasmid # 194928 ; http://n2t.net/addgene:194928 ; RRID:Addgene_194928) -
For your References section:
Intranasal Immunization with a Recombinant Adenovirus Encoding Multi-Stage Antigens of Mycobacterium tuberculosis Preferentially Elicited CD8(+) T Cell Immunity and Conferred a Superior Protection in the Lungs of Mice than Bacillus Calmette-Guerin. Wang L, Kang J, Jiang H. Vaccines (Basel). 2024 Sep 6;12(9):1022. doi: 10.3390/vaccines12091022. 10.3390/vaccines12091022 PubMed 39340053