Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pOPO640
(Plasmid #195296)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 195296 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTA106
  • Backbone size w/o insert (bp) 4217
  • Total vector size (bp) 3961
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    miniMcCAST (Tn7575) with KanR
  • Species
    Myxacorys californica WJT36-NPBG1
  • Insert Size (bp)
    1859
  • GenBank ID
    JAHHHO010000011

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer tacatatcaaagggaaaactgtccatatg
  • 3′ sequencing primer AGGCTTAAGTAGCACCCTCGCAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOPO640 was a gift from Joseph Peters (Addgene plasmid # 195296 ; http://n2t.net/addgene:195296 ; RRID:Addgene_195296)
  • For your References section:

    Discovery and characterization of novel type I-D CRISPR-guided transposons identified among diverse Tn7-like elements in cyanobacteria. Hsieh SC, Peters JE. Nucleic Acids Res. 2023 Jan 25;51(2):765-782. doi: 10.1093/nar/gkac1216. 10.1093/nar/gkac1216 PubMed 36537206