Skip to main content

Pb-TRE3G-TYR-HygR
(Plasmid #195508)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195508 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    piggyBac
  • Backbone size w/o insert (bp) 8017
  • Total vector size (bp) 9705
  • Vector type
    Mammalian Expression ; piggyBac
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TYR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1688
  • Entrez Gene
    TYR (a.k.a. ATN, CMM8, OCA1, OCA1A, OCAIA, SHEP3)
  • Promoter TRE

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer cacccgtgcgttttattctg
  • 3′ sequencing primer atcgcctggagcaattccac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Pb-TRE3G-TYR-HygR was a gift from Joanna Wysocka (Addgene plasmid # 195508 ; http://n2t.net/addgene:195508 ; RRID:Addgene_195508)
  • For your References section:

    A genome-wide genetic screen uncovers determinants of human pigmentation. Bajpai VK, Swigut T, Mohammed J, Naqvi S, Arreola M, Tycko J, Kim TC, Pritchard JK, Bassik MC, Wysocka J. Science. 2023 Aug 11;381(6658):eade6289. doi: 10.1126/science.ade6289. Epub 2023 Aug 11. 10.1126/science.ade6289 PubMed 37561850