hU6-pegRNA-EFS-mScarlet Template
(Plasmid
#196037)
-
PurposeThe template UPEmS vector designed for cloning of a single pegRNA and subsequent co-expression with mScarlet.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196037 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLenti-gibson backbone vector
-
Backbone manufacturerJacks Lab
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemScarlet
-
SpeciesSynthetic
-
Insert Size (bp)699
- Promoter hU6 and EFS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACCCGACATTAGCGCTACAGCTTAAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hU6-pegRNA-EFS-mScarlet Template was a gift from Tyler Jacks (Addgene plasmid # 196037 ; http://n2t.net/addgene:196037 ; RRID:Addgene_196037) -
For your References section:
A prime editor mouse to model a broad spectrum of somatic mutations in vivo. Ely ZA, Mathey-Andrews N, Naranjo S, Gould SI, Mercer KL, Newby GA, Cabana CM, Rideout WM 3rd, Jaramillo GC, Khirallah JM, Holland K, Randolph PB, Freed-Pastor WA, Davis JR, Kulstad Z, Westcott PMK, Lin L, Anzalone AV, Horton BL, Pattada NB, Shanahan SL, Ye Z, Spranger S, Xu Q, Sanchez-Rivera FJ, Liu DR, Jacks T. Nat Biotechnol. 2023 May 11. doi: 10.1038/s41587-023-01783-y. 10.1038/s41587-023-01783-y PubMed 37169967