AAV-GfaABC1D-lck-smFLAG-4x6T-WPRE
(Plasmid
#196414)
-
PurposeAstrocytic expression of membrane-targeted FLAG spaghetti monster reporter in AAV; astrocyte specificity enhanced with 4x6T miRNA targeting cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196414 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 3406
- Total vector size (bp) 6644
-
Modifications to backboneThe GfaABC1D promoter and the 4x6T miRNA targeting cassette were added to confer astrocyte specificity.
-
Vector typeMammalian Expression, AAV ; Astrocyte-selective
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLck-smFLAG
-
Alt namemembrane targeted FLAG spaghetti monster
-
Alt namesmFP_FLAG
-
SpeciesSynthetic
-
Insert Size (bp)1158
- Promoter GfaABC1D
-
Tag
/ Fusion Protein
- Lck (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tagcccactccttcataaag
- 3′ sequencing primer ttattaggacaaggctggtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAAV-GfaABC1D-lck-smFLAG-4x6T was created using AAV pmSyn1-EBFP-Cre (Addgene 51507) provided by Hongkui Zeng and smFLAG (Addgene 59756) provided by Loren Looger.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.02.21.529451v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-GfaABC1D-lck-smFLAG-4x6T-WPRE was a gift from Stanley Thomas Carmichael (Addgene plasmid # 196414 ; http://n2t.net/addgene:196414 ; RRID:Addgene_196414) -
For your References section:
A toolbox of astrocyte-specific, serotype-independent adeno-associated viral vectors using microRNA targeting sequences. Gleichman AJ, Kawaguchi R, Sofroniew MV, Carmichael ST. Nat Commun. 2023 Nov 16;14(1):7426. doi: 10.1038/s41467-023-42746-w. 10.1038/s41467-023-42746-w PubMed 37973910