AAV-CAG-dDIO-lck-smMyc-4x6T
(Plasmid
#196421)
-
PurposeDre-dependent AAV expression of membrane-targeted Myc spaghetti monster reporter preferentially in astrocytes; astrocyte selectivity generated with 4x6T miRNA targeting cassette
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196421 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV-FLEX (Addgene 28304)
-
Backbone manufacturerScott Sternson
- Backbone size w/o insert (bp) 4699
- Total vector size (bp) 6829
-
Modifications to backboneReplaced loxP/lox2272 sites with roxP/rox2 sites; added 4x6T miR targeting cassette for astrocyte selectivity
-
Vector typeMammalian Expression, AAV ; Dre/Rox; astrocyte-selective
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLck-smMyc
-
Alt namemembrane targeted Myc spaghetti monster
-
Alt namesmFP_Myc
-
SpeciesSynthetic
-
Insert Size (bp)1224
- Promoter CAG
-
Tag
/ Fusion Protein
- Lck (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer ttaaagcagcgtatccacat
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAAV-CAG-dDIO-lck-smMyc-4x6T was created using pAAV-FLEX-GFP (Addgene 28304) provided by Ed Boyden; dDIO sites (Addgene 55640) provided by Karl Deisseroth; and smFP_Myc (Addgene 59757) provided by Loren Looger.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.02.21.529451v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CAG-dDIO-lck-smMyc-4x6T was a gift from Stanley Thomas Carmichael (Addgene plasmid # 196421 ; http://n2t.net/addgene:196421 ; RRID:Addgene_196421) -
For your References section:
A toolbox of astrocyte-specific, serotype-independent adeno-associated viral vectors using microRNA targeting sequences. Gleichman AJ, Kawaguchi R, Sofroniew MV, Carmichael ST. Nat Commun. 2023 Nov 16;14(1):7426. doi: 10.1038/s41467-023-42746-w. 10.1038/s41467-023-42746-w PubMed 37973910