pLentiCRISPRv1 sgTollip
(Plasmid #196546)

• Purpose: Lentiviral CRISPR-Cas9 plasmid containing gRNA targeting exon 1 of human Tollip. Used for generation of Tollip protein knockouts in human cell lines.
• Depositing Lab: David Tumbarello
• Publication: Ryan et al EMBO J. 2020 Jun 2;39(11):e102539. doi: 10.15252/embj.2019102539. Epub 2020 Apr 20.

Backbone

• Vector backbone: pLentiCRISPRv1
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Toll-Interacting Protein
• Alt name: IL-1RAcPIP
• gRNA/shRNA sequence: ACCACCGTCAGCACTCAGCG
• Species: H. sapiens (human)
• Entrez Gene: TOLLIP (a.k.a. IL-1RAcPIP)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: ACTATCATATGCTTACCGTAAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry