-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 19761 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1 puro
- Backbone size w/o insert (bp) 7032
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesmall hairpin RNA against beta-catenin
-
Alt nameCTNNB
-
SpeciesH. sapiens (human)
-
Entrez GeneCTNNB1 (a.k.a. CTNNB, EVR7, MRD19, NEDSDV, armadillo)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Reference
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
1248 refers to the shRNA
clone name from the RNAi Consortium at the Broad Institute and indicates the
location on the CTNNB1 mRNA that is targeted.
shRNA sequence for 1248 is: CCGGAGGTGCTATCTGTCTGCTCTACTCGAGTAGAGCAGACAGATAGCACCTTTTTT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1.sh.beta-catenin.1248 was a gift from William Hahn (Addgene plasmid # 19761 ; http://n2t.net/addgene:19761 ; RRID:Addgene_19761) -
For your References section:
CDK8 is a colorectal cancer oncogene that regulates beta-catenin activity. Firestein R, Bass AJ, Kim SY, Dunn IF, Silver SJ, Guney I, Freed E, Ligon AH, Vena N, Ogino S, Chheda MG, Tamayo P, Finn S, Shrestha Y, Boehm JS, Jain S, Bojarski E, Mermel C, Barretina J, Chan JA, Baselga J, Tabernero J, Root DE, Fuchs CS, Loda M, Shivdasani RA, Meyerson M, Hahn WC. Nature. 2008 Sep 25. 455(7212):547-51. 10.1038/nature07179 PubMed 18794900