Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLKO.1.sh.beta-catenin.1248
(Plasmid #19761)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 19761 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1 puro
  • Backbone size w/o insert (bp) 7032
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    small hairpin RNA against beta-catenin
  • Alt name
    CTNNB
  • Species
    H. sapiens (human)
  • Entrez Gene
    CTNNB1 (a.k.a. CTNNB, EVR7, MRD19, NEDSDV, armadillo)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

1248 refers to the shRNA
clone name from the RNAi Consortium at the Broad Institute and indicates the
location on the CTNNB1 mRNA that is targeted.

shRNA sequence for 1248 is: CCGGAGGTGCTATCTGTCTGCTCTACTCGAGTAGAGCAGACAGATAGCACCTTTTTT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1.sh.beta-catenin.1248 was a gift from William Hahn (Addgene plasmid # 19761 ; http://n2t.net/addgene:19761 ; RRID:Addgene_19761)
  • For your References section:

    CDK8 is a colorectal cancer oncogene that regulates beta-catenin activity. Firestein R, Bass AJ, Kim SY, Dunn IF, Silver SJ, Guney I, Freed E, Ligon AH, Vena N, Ogino S, Chheda MG, Tamayo P, Finn S, Shrestha Y, Boehm JS, Jain S, Bojarski E, Mermel C, Barretina J, Chan JA, Baselga J, Tabernero J, Root DE, Fuchs CS, Loda M, Shivdasani RA, Meyerson M, Hahn WC. Nature. 2008 Sep 25. 455(7212):547-51. 10.1038/nature07179 PubMed 18794900