pCAG-EGFP/RFP-miR-E2-4int
(Plasmid
#19820)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 19820 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAG-EGFP/RFP-int
- Backbone size w/o insert (bp) 8200
-
Vector typeMammalian Expression, RNAi, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiRNA
-
Insert Size (bp)400
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AsiSI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer GCTGGACATCACCTCCCACAACG
- 3′ sequencing primer ACAGGAGGTGGGGAGCAGGAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A fragment of ~400 bases surrounding the miRNA insertion site was amplified from the first intron of the vector pUbC-miRNA-EGFP [36] with primers 5'-GCAATGACGCGATCGCTAATGCGGGAAAGCTCTTATTCGGGT-3' (forward) and 5'-AAGGCATGACGCGTTGTTGCGGCCGCCAGAGGTCCGGCGCCTGT-3' (reverse).
miR-E2-4:
GGTACCTGCTGTTGACAGTGAGCGAGAAGTGGTGTATCTAGAGATTATAGTGAAGCCACAGATGTATAATCTCTATACACCACTTCCTGCCTACTGCCTCGGACTTCAAGGGGAATTC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-EGFP/RFP-miR-E2-4int was a gift from Zuoshang Xu (Addgene plasmid # 19820 ; http://n2t.net/addgene:19820 ; RRID:Addgene_19820) -
For your References section:
A construct with fluorescent indicators for conditional expression of miRNA. Qiu L, Wang H, Xia X, Zhou H, Xu Z. BMC Biotechnol. 2008 Oct 7;8:77. doi: 10.1186/1472-6750-8-77. 10.1186/1472-6750-8-77 PubMed 18840295