pcDNA3.1-CMV-PdCO-mScarlet
(Plasmid
#198507)
-
PurposeExpresses optimized PdCO in frame with mScarlet under control of CMV promotor.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198507 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5375
- Total vector size (bp) 7271
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePdCO
-
Alt namePlatynereis dumerilii Ciliary Opsin, optimized for mammalian neuron expression and enhanced axonal membrane trafficking
-
SpeciesSynthetic; Platynereis dumerilii
-
Insert Size (bp)1896
-
GenBank IDAY692353.1
- Promoter CMV
-
Tags
/ Fusion Proteins
- mScarlet (C terminal on insert)
- Rho1D4 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CMV_F (GTAACAACTCCGCCCCATTG)
- 3′ sequencing primer bGH_R (GCACCTTCCAGGGTCAAGGAA )
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.07.01.547328v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-CMV-PdCO-mScarlet was a gift from Ofer Yizhar (Addgene plasmid # 198507 ; http://n2t.net/addgene:198507 ; RRID:Addgene_198507) -
For your References section:
A bistable inhibitory optoGPCR for multiplexed optogenetic control of neural circuits. Wietek J, Nozownik A, Pulin M, Saraf-Sinik I, Matosevich N, Gowrishankar R, Gat A, Malan D, Brown BJ, Dine J, Imambocus BN, Levy R, Sauter K, Litvin A, Regev N, Subramaniam S, Abrera K, Summarli D, Goren EM, Mizrachi G, Bitton E, Benjamin A, Copits BA, Sasse P, Rost BR, Schmitz D, Bruchas MR, Soba P, Oren-Suissa M, Nir Y, Wiegert JS, Yizhar O. Nat Methods. 2024 May 29. doi: 10.1038/s41592-024-02285-8. 10.1038/s41592-024-02285-8 PubMed 38811857