pAAV-hSyn-SIO-PdCO-mScarlet-WPRE
(Plasmid
#198509)
-
PurposeExpresses optimized PdCO in frame with mScarlet under control of human synapsin1 promotor after Cre-dependent recombination.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198509 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4621
- Total vector size (bp) 6517
-
Modifications to backbonedirectional Cre-Lox sites
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePdCO
-
Alt namePlatynereis dumerilii Ciliary Opsin, optimized for mammalian neuron expression and enhanced axonal membrane trafficking
-
SpeciesSynthetic; Platynereis dumerilii
-
Insert Size (bp)1896
-
GenBank IDAY692353.1
- Promoter hSyn1
-
Tags
/ Fusion Proteins
- mScarlet (C terminal on insert)
- Rho1D4 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer hSyn_F (ttcagcaccgcggacagtg)
- 3′ sequencing primer WPRE_R (ggagcaacatagttaagaataccagtcaatct)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.07.01.547328v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-SIO-PdCO-mScarlet-WPRE was a gift from Ofer Yizhar (Addgene plasmid # 198509 ; http://n2t.net/addgene:198509 ; RRID:Addgene_198509) -
For your References section:
A bistable inhibitory optoGPCR for multiplexed optogenetic control of neural circuits. Wietek J, Nozownik A, Pulin M, Saraf-Sinik I, Matosevich N, Gowrishankar R, Gat A, Malan D, Brown BJ, Dine J, Imambocus BN, Levy R, Sauter K, Litvin A, Regev N, Subramaniam S, Abrera K, Summarli D, Goren EM, Mizrachi G, Bitton E, Benjamin A, Copits BA, Sasse P, Rost BR, Schmitz D, Bruchas MR, Soba P, Oren-Suissa M, Nir Y, Wiegert JS, Yizhar O. Nat Methods. 2024 May 29. doi: 10.1038/s41592-024-02285-8. 10.1038/s41592-024-02285-8 PubMed 38811857