Skip to main content

DiLiCre 2.0
(Plasmid #198752)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198752 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    #71666 pdCas9-DNMT3A-EGFP
  • Backbone manufacturer
    Vlatka Zoldos
  • Backbone size w/o insert (bp) 8020
  • Total vector size (bp) 12093
  • Vector type
    Mammalian Expression, Bacterial Expression, Lentiviral
  • Selectable markers
    Zeocin ; Bleomycin, Phleomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cre-PhoCI-ERT2-ERT2
  • Alt name
    DiLiCre 2.0
  • Species
    Synthetic
  • Insert Size (bp)
    3686
  • GenBank ID
  • Promoter TRE3GV
  • Tag / Fusion Protein
    • Cre, kept in a photocleavable site, followed by 2 ERT2 domains. (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GAAGAGGTACACCAGCACCAAAG
  • 3′ sequencing primer cgaggtcgacggtatcg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    backbone: pdCas9-DNMT3A-EGFP (Vlatka Zoldoš), DNA fragments: pCAG-ERT2-PhoCl-Cre-PhoCl-ERT2 (Robert Campbell), TRE-KRAB-dCas9-IRES-GFP (Eric Lander). For more information: see comments

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cloning was performed using a third generation lentiviral plasmid as a backbone (pdCas9-DNMT3A-EGFP (Vlatka Zoldoš, #71666)) digested with NheI-EcoRI and ligated to the following DNA fragments: TREGV 3rd generation promoter (amplified by PCR using TRE-KRAB-dCas9-IRES-GFP (Eric Lander, #85556) as a template and digested with NheI-XmaI), PhoCl-ERT2-Cre-ERT2-PhoCl sequence (pCAG-ERT2-PhoCl-Cre-PhoCl-ERT2 (Robert Campbell, #87694)) digested with XmaI-NotI, and NotI-EcoRI adapter. From construct PhoCl-ERT2-Cre-ERT2-PhoCl, the sequence Cre-PhoCl-ERT2 was amplified. Cre sequence from the original construct lacked the canonical first 16 aminoacids (MANLLTVHQNLPALPV), so we restored them. The synthesized fragment was ligated into the pCAG-ERT2-PhoCl-Cre-PhoCl-ERT2 vector upon PacI and EcoRI digestion. Using this as a template, we amplified Cre-PhoCl-ERT2 sequence to generate a new fragment flanked by PacI and AscI restriction sites. An additional ERT2 domain was synthetized by PCR with AscI and EcoRI ends and one 5′-GSGSGGG flexible linker. Upon digestion, the two fragments were ligated into the pCAG-ERT2-PhoCl-Cre-PhoCl-ERT2 vector upon PacI and EcoRI digestion. Finally, Cre-PhoCl-ERT2(x2) fragment was jumped into the PiggyBac XLone vector system25. To this end, XLone plasmid backbone was PCR and Cre-PhoCl-ERT2(x2) cassette ligated upon NheI-NotI digestion.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DiLiCre 2.0 was a gift from Jacco van Rheenen (Addgene plasmid # 198752 ; http://n2t.net/addgene:198752 ; RRID:Addgene_198752)
  • For your References section:

    A doxycycline- and light-inducible Cre recombinase mouse model for optogenetic genome editing. Vizoso M, E J Pritchard C, Bombardelli L, van den Broek B, Krimpenfort P, Beijersbergen RL, Jalink K, van Rheenen J. Nat Commun. 2022 Oct 28;13(1):6442. doi: 10.1038/s41467-022-33863-z. 10.1038/s41467-022-33863-z PubMed 36307419