Skip to main content

EF1α-Lox2272-LoxP-MARKS·mTurquoise2-NLS·turboRFP-Lox2272-LoxP
(Plasmid #198753)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198753 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    #37120 pAAV-EF1a-DO_DIO-TdTomato_EGFP-WPRE-pA
  • Backbone manufacturer
    K. Deisseroth Lab
  • Backbone size w/o insert (bp) 5627
  • Total vector size (bp) 11151
  • Vector type
    Mammalian Expression, Bacterial Expression, Lentiviral
  • Selectable markers
    Zeocin ; Bleomycin, Phleomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EF1a promotor-Lox2272-LoxP-MARKS-mTurquoise2-NLS.turboRFP-Lox2272-LOXP
  • Alt name
    membraneTq2 - NLS.turboRFP
  • Species
    Synthetic
  • Insert Size (bp)
    2893
  • Mutation
    See depositor comments below
  • GenBank ID
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTTCCATTTCAGGTGTCGTG
  • 3′ sequencing primer cgaggtcgacggtatcg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    backbone:pAAV-Ef1a-DO_DIO-TdTomato_EGFP-WPRE-pA (Bernardo Sabatini), inserts: Rosa26 mT/mG (Liqun Luo), pK263.CAG-loxP-stop-loxP-NLSturboRFP-ires-tTA-WPRE (Takuji Iwasato). For more information, see comments

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Using pAAV-Ef1a-DO_DIO-TdTomato_EGFP-WPRE-pA (Bernardo Sabatini, #37120) as a backbone (cut AscI/NheI), we ligated the following fragments: first, we PCR the membrane bound sequence (MARKS, Rosa26 mT/mG (Liqun Luo), #17787), the mTurquoise2 sequence (+stop codon), and the nuclear NLS·turboRFP sequence (+stop codon) from pK263.CAG-loxP-stop-loxP-NLSturboRFP-ires-tTA-WPRE (Takuji Iwasato, #89587). MARKS was fused by PCR to mTurquoise2 using forward overlapping regions and NLS·turboRFP was fused to mTurquoise2 in a reversed orientation. The fusion product was ligated to the lentiviral backbone using the AscI-NheI restriction enzyme sites.

Please note: The plasmid contains AQ3-4CC mutations in MARCKS compared to the NCBI reference sequence AAH28284.1. These mutations are not expected to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EF1α-Lox2272-LoxP-MARKS·mTurquoise2-NLS·turboRFP-Lox2272-LoxP was a gift from Jacco van Rheenen (Addgene plasmid # 198753 ; http://n2t.net/addgene:198753 ; RRID:Addgene_198753)
  • For your References section:

    A doxycycline- and light-inducible Cre recombinase mouse model for optogenetic genome editing. Vizoso M, E J Pritchard C, Bombardelli L, van den Broek B, Krimpenfort P, Beijersbergen RL, Jalink K, van Rheenen J. Nat Commun. 2022 Oct 28;13(1):6442. doi: 10.1038/s41467-022-33863-z. 10.1038/s41467-022-33863-z PubMed 36307419