pLVX LYCHOS-FLAG-TiD
(Plasmid
#199747)
-
PurposeLentiviral construct to stably express LYCHOS (GPR155) TurboID
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199747 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLVX
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLYCHOS
-
Alt nameGPR155
-
SpeciesH. sapiens (human)
-
Entrez GeneGPR155 (a.k.a. DEP.7, DEPDC3, PGR22)
- Promoter EF1a
-
Tags
/ Fusion Proteins
- Flag (C terminal on insert)
- TurboID (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX LYCHOS-FLAG-TiD was a gift from Roberto Zoncu (Addgene plasmid # 199747 ; http://n2t.net/addgene:199747 ; RRID:Addgene_199747) -
For your References section:
Lysosomal GPCR-like protein LYCHOS signals cholesterol sufficiency to mTORC1. Shin HR, Citron YR, Wang L, Tribouillard L, Goul CS, Stipp R, Sugasawa Y, Jain A, Samson N, Lim CY, Davis OB, Castaneda-Carpio D, Qian M, Nomura DK, Perera RM, Park E, Covey DF, Laplante M, Evers AS, Zoncu R. Science. 2022 Sep 16;377(6612):1290-1298. doi: 10.1126/science.abg6621. Epub 2022 Aug 25. 10.1126/science.abg6621 PubMed 36007018