Skip to main content
Addgene
Open Menu

pLVX NPC1-FLAG-TiD
(Plasmid #199748)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199748 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 199748-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 199748-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pLVX
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NPC1
  • Alt name
    NPC
  • Species
    H. sapiens (human)
  • GenBank ID
    4864
  • Entrez Gene
    NPC1 (a.k.a. NPC, POGZ, SLC65A1)
  • Promoter EF1a
  • Tags / Fusion Proteins
    • Flag (C terminal on insert)
    • TurboID (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mutations in NPC1 insert at amino acids 1279-1287 will not affect plasmid function

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX NPC1-FLAG-TiD was a gift from Roberto Zoncu (Addgene plasmid # 199748 ; http://n2t.net/addgene:199748 ; RRID:Addgene_199748)

  • For your References section:

    Lysosomal GPCR-like protein LYCHOS signals cholesterol sufficiency to mTORC1. Shin HR, Citron YR, Wang L, Tribouillard L, Goul CS, Stipp R, Sugasawa Y, Jain A, Samson N, Lim CY, Davis OB, Castaneda-Carpio D, Qian M, Nomura DK, Perera RM, Park E, Covey DF, Laplante M, Evers AS, Zoncu R. Science. 2022 Sep 16;377(6612):1290-1298. doi: 10.1126/science.abg6621. Epub 2022 Aug 25. 10.1126/science.abg6621 PubMed 36007018
Related items:
Commonly requested with: