pCRISPRi
(Plasmid
#199808)
-
Purposevector for constitutive CRISPRi-mediated gene knockdown in S. aureus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199808 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCN50
- Backbone size w/o insert (bp) 5750
-
Modifications to backboneSite directed mutagenesis to remove BSAI site in AmpR gene. Replacement of the temperature sensitive S. aureus pT181cop-634 replicon with the wild type pT181 replicon. Vector modified to carry dead Cas9, and an sgRNA cassette. sgRNA has a GFP-expression construct cloned into its BSAI site to facilitate screening for successful cloning of targeting constructs (successful cloning events excise the GFP and colonies do not fluoresce) .
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsChloramphenicol selection in S. aureus, Ampicillin selection in E. coli. Temperature sensitive replicon must be maintained at 32 degrees in S. aureus. Stable at 37 degrees in E. coli.
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namedCas9
-
Insert Size (bp)4297
- Promoter P23
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SbfI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer AAACCTGCAGGGCTGGCGGCCGCTGCATGatgacaaaaagagcaaaattttgataaaatagtattagTCGACAAAGGAGGCAAAAATGG
- 3′ sequencing primer AAACCCGGGagtcttgaaaagcccctgtattact
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesgRNA with GFP cassette
-
SpeciesSynthetic
-
Insert Size (bp)1519
- Promoter PRAB17 (sgRNA) and SarAP1 (GFP)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site KasI (not destroyed)
- 3′ cloning site KasI (not destroyed)
- 5′ sequencing primer AAAAATATGAACactctatcattg
- 3′ sequencing primer CGGTGCCACTTTTTCAAGTT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See source publication for detailed protocols describing this vector's use.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPRi was a gift from Steve Salipante (Addgene plasmid # 199808 ; http://n2t.net/addgene:199808 ; RRID:Addgene_199808) -
For your References section:
Clinical and in vitro models identify distinct adaptations enhancing Staphylococcus aureus pathogenesis in human macrophages. Long DR, Holmes EA, Lo HY, Penewit K, Almazan J, Hodgson T, Berger NF, Bishop ZH, Lewis JD, Waalkes A, Wolter DJ, Salipante SJ. PLoS Pathog. 2024 Jul 11;20(7):e1012394. doi: 10.1371/journal.ppat.1012394. eCollection 2024 Jul. 10.1371/journal.ppat.1012394 PubMed 38991026