QUAS-jGCaMP7s-T2A-tdTomato
(Plasmid
#200010)
-
PurposeQUAS reporter line expressing GCaMP7s calcium indicator and tdTomato, separated by T2A
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200010 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneampilfied from 15xQUAS-Syt1-tdTomato-3XP3-ECFP
- Backbone size w/o insert (bp) 3377
- Total vector size (bp) 9523
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3xP3-ECFP-jGCaMP7s-td-Tomato
-
Insert Size (bp)4809
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We used pBac-mediated transposition according to a previously published method to generate a QUAS-jGCaMP7s-T2A-tdTomato effector strain that could be used in concert with a pan-neuronal driver to image from all glomeruli. We generated the template for in vitro transcription of pBac mRNA via PCR amplification from a plasmid containing the pBac coding sequence (a gift from Leslie Vosshall; primers forward 5’- GAAACTAATACGACTCACTATAGGGAGAGCCGCCACATGGGTAGTTCTTTAGACGATG
-3’, reverse 5’- CTTATTAGTCAGTCAGAAACAAC -3’). The PCR amplicon was purified using RNAse-free SPRI beads (Agencourt RNAclean XP, Beckman-Coulter A63987) and then used for in vitro transcription with the HiScribe T7 ARCA mRNA Kit (with tailing, NEB, E2060S). Transcription products were purified using RNAse-free SPRI beads, and eluted in Ambion nuclease-free water (Life Technologies, AM9937). The transgene plasmid was generated using the InFusion HD Kit (Clontech, 638910) and the NucleoBond Xtra Midi EF Kit (Macherey-Nagel, 740420.10). jGCaMP7s was cloned from a Drosophila melanogaster fly that contained the jGCaMP7s transgene (a gift from Mala Murthy; primers forward 5’- CGCGGCTCGAGCAAAATGGGCTCACATCATCACCA -3’, reverse 5’- GGCCCTCTCCCGATCCTTTGGCGGTCATCATTTGTACG -3’).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
QUAS-jGCaMP7s-T2A-tdTomato was a gift from Carolyn McBride (Addgene plasmid # 200010 ; http://n2t.net/addgene:200010 ; RRID:Addgene_200010) -
For your References section:
Mosquito brains encode unique features of human odour to drive host seeking. Zhao Z, Zung JL, Hinze A, Kriete AL, Iqbal A, Younger MA, Matthews BJ, Merhof D, Thiberge S, Ignell R, Strauch M, McBride CS. Nature. 2022 May;605(7911):706-712. doi: 10.1038/s41586-022-04675-4. Epub 2022 May 4. 10.1038/s41586-022-04675-4 PubMed 35508661