Skip to main content
Addgene

pAAV-TRE3_ mTFP1- Vamp2
(Plasmid #201214)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201214 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-TRE-flex-Clover
  • Backbone manufacturer
    addgene Plasmid #135177
  • Modifications to backbone
    Replacement of flex-clover insert with mTFP-Vamp2 (WPRE is retained)
  • Vector type
    Mammalian Expression, Bacterial Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mTFP1 (from addgene #54613)
  • Species
    Clavularia sp.
  • Promoter TRE3G
  • Tag / Fusion Protein
    • mouse Vamp2 (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TGTAAAACGACGGCCAGT
  • 3′ sequencing primer GGCATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2021.12.26.474213 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-TRE3_ mTFP1- Vamp2 was a gift from Tetsuo Yamamori (Addgene plasmid # 201214 ; http://n2t.net/addgene:201214 ; RRID:Addgene_201214)
  • For your References section:

    Local and long-distance organization of prefrontal cortex circuits in the marmoset brain. Watakabe A, Skibbe H, Nakae K, Abe H, Ichinohe N, Rachmadi MF, Wang J, Takaji M, Mizukami H, Woodward A, Gong R, Hata J, Van Essen DC, Okano H, Ishii S, Yamamori T. Neuron. 2023 May 9:S0896-6273(23)00338-0. doi: 10.1016/j.neuron.2023.04.028. 10.1016/j.neuron.2023.04.028 PubMed 37196659