-
PurposeE. coli vector expressing FrbA, FrbB, FrbC, FrbD and FrbE for the biosynthesis of non-hydrolyzable phosphoserine from phosphoenolpyruvate.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201923 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDF
- Total vector size (bp) 11331
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameFrbA
-
SpeciesStreptomyces rubellomurinus
-
Insert Size (bp)2664
-
GenBank IDWP_045699988
- Promoter T7 (modified, weak)
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer CCATACCGCGAAAGGTTTTGCG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameFrbB
-
SpeciesStreptomyces rubellomurinus
-
Insert Size (bp)1062
-
GenBank IDWP_045699989
- Promoter T7 (modified, moderate)
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer GTCGGACCTCTTAGACGCCG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameFrbC
-
SpeciesStreptomyces rubellomurinus
-
GenBank IDWP_045699990
- Promoter T7 (unmodified)
Cloning Information for Gene/Insert 3
- Cloning method Gateway Cloning
- 5′ sequencing primer AAAAGTCTACGTGCCGAAGGC
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameFrbD
-
SpeciesStreptomyces rubellomurinus
-
Insert Size (bp)834
-
GenBank IDABB90393
- Promoter T7 (unmodified)
Cloning Information for Gene/Insert 4
- Cloning method Gateway Cloning
- 5′ sequencing primer TCTACAACAAAGCCGCAGCG
- (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameFrbE
-
SpeciesStreptomyces rubellomurinus
-
Insert Size (bp)1101
-
GenBank IDWP_045699992
- Promoter T7 (modified)
Cloning Information for Gene/Insert 5
- Cloning method Gateway Cloning
- 5′ sequencing primer AGCGAAGTGTTCGAACTGCAAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The pCDF-Frb-v1 plasmid can be propagated reliably in DH10b cells, but it is good practice to minimize the number of propagations. Upon receiving cells and growing a colony overnight in liquid culture, make a frozen glycerol stock of these Dh10b cells containing plasmid. This glycerol stock can be used to inoculate future cultures for isolating more plasmid.
Glycerol stocks can be made by mixing 600 uL of overnight culture with 400 uL of 50% (v/v) sterile glycerol and placing tube in a -80C freezer.
This plasmid should be paired with pERM2-nhpSer (#201922, which enables translational encoding of the biosynthesized non-hydrolyzable phosphoserine amino acid) and a compatible plasmid expressing protein of interest (e.g. #174076 for a sfGFP-150TAG control) in the cell line BL21(DE3) deltaSerC (#197656). This system is used to translationally incorporate non-hydrolyzable phosphoserine into target proteins at TAG amber stop codons in E coli.
This plasmid exists as a dimer. This is not expected to impact the end function of the plasmid and the depositor recommends that the plasmid should be used exactly as provided. However, please refer to the Addgene Blog post on multimers for more information: https://blog.addgene.org/plasmids-101-dimers-and-multimers
Additionally, a small insertion in the CloDF13 ori sequence has been identified in one half of the plasmid dimer. The depositor has confirmed that this has not impacted plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDF-Frb-v1 was a gift from Richard Cooley & Ryan Mehl (Addgene plasmid # 201923 ; http://n2t.net/addgene:201923 ; RRID:Addgene_201923) -
For your References section:
Autonomous Synthesis of Functional, Permanently Phosphorylated Proteins for Defining the Interactome of Monomeric 14-3-3zeta. Zhu P, Stanisheuski S, Franklin R, Vogel A, Vesely CH, Reardon P, Sluchanko NN, Beckman JS, Karplus PA, Mehl RA, Cooley RB. ACS Cent Sci. 2023 Apr 10;9(4):816-835. doi: 10.1021/acscentsci.3c00191. eCollection 2023 Apr 26. 10.1021/acscentsci.3c00191 PubMed 37122473