pLenti-CMV-Pink Flamindo-p2a-bPAC
(Plasmid
#202716)
-
PurposeMammalian co-expression of soluble Pink Flamindo, a fluorescent cAMP indicator and soluble bPAC, a photoactivatable adenylyl cyclase
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202716 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti
- Backbone size w/o insert (bp) 8538
- Total vector size (bp) 10905
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namePink Flamindo
-
SpeciesSynthetic
-
Insert Size (bp)1173
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer agaagacaccgactctagaggatc
- 3′ sequencing primer aagttcgtggctccggagcCCTTGTACAGCTCGTCCATGC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namebPAC
-
SpeciesSynthetic; Beggiatoa sp.
-
Insert Size (bp)1128
-
Tags
/ Fusion Proteins
- myc (C terminal on insert)
- 10xHis (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer tggaagaaaaccccggtcccATGAAGCGGCTGGTGTAC
- 3′ sequencing primer tatcgataagcttgatatcgaattcTTACTCGAGATGGTGATGGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-CMV-Pink Flamindo-p2a-bPAC was a gift from Adam Cohen (Addgene plasmid # 202716 ; http://n2t.net/addgene:202716 ; RRID:Addgene_202716) -
For your References section:
All-optical mapping of cAMP transport reveals rules of sub-cellular localization. Xiang KM, Park P, Koren SA, Hayward RF, Cohen AE. bioRxiv 2023 10.1101/2023.06.27.546633